circad | circRNAs associated with diseases

chr19:49158646\|49159228
Gene	Cdyl2	Organism	Rat
Genome Locus	chr19:49158646-49159228	Build	n/a
Disease	Lung Injury	ICD-10	Other injuries of lung (S27.3)
DBLink	Link to database	PMID	29188496
Experimental Method
Sample Type	Tissues	Comparison	lung tissues of the 24-h group and the control group (smoke inhalation)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGGAGACCAGTGATTGCGAC Reverse GCCGTAGCCTTTCCATCGG	Statistics	Fold Change : Downregulated pvalue : 1.2007E−89
Citation
Ye, Z, Liu, X, Yang, Y, Zhang, X, Yu, T, Li, S, Feng, Y, Luo, G (2018). The differential expression of novel circular RNAs in an acute lung injury rat model caused by smoke inhalation. J. Physiol. Biochem., 74, 1:25-33.